Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00690 |
---|---|
Accession No | AB023156 |
Description | solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8, transcript variant 2 |
Clone name | hh04825s1 |
Vector information | |
cDNA sequence | DNA sequence (6087 bp) Predicted protein sequence (595 aa) |
HaloTag ORF Clone |
FHC00690
|
Flexi ORF Clone | FXC00690 |
Source | Human adult brain |
Rouge ID |
mKIAA0939
by Kazusa Mouse cDNA Project
|
Note | We replaced hh04825, former representative clones for KIAA0939 with hh04825s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4299 bp |
---|---|
Genome contig ID | gi51511747f_47762825 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (179356 - 179405) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | f | 47862825 | 47942179 | 16 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR004709 | 139 | 150 | PR01084 | Sodium/hydrogen exchanger subfamily |
IPR004709 | 153 | 167 | PR01084 | Sodium/hydrogen exchanger subfamily | |
IPR004709 | 168 | 176 | PR01084 | Sodium/hydrogen exchanger subfamily | |
IPR004709 | 208 | 218 | PR01084 | Sodium/hydrogen exchanger subfamily | |
HMMPfam | IPR006153 | 76 | 487 | PF00999 | Sodium/hydrogen exchanger |
HMMTigr | IPR004709 | 67 | 590 | TIGR00840 | Sodium/hydrogen exchanger subfamily |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 30 | HEGFNVTLHTTLVVTTKLVLPTP | 52 | SECONDARY | 23 | 2 | 74 | MTIFFSLLVLAICIILVHLLIR | 95 | PRIMARY | 22 | 3 | 102 | PESVAVVSLGILMGAVIKIIEF | 123 | PRIMARY | 22 | 4 | 166 | GSITLFAVFGTAISAFVVGGGIY | 188 | PRIMARY | 23 | 5 | 201 | MTDSFAFGSLISAVDPVATIAIF | 223 | SECONDARY | 23 | 6 | 278 | FLKMFFGSAALGTLTGLISALVL | 300 | SECONDARY | 23 | 7 | 328 | EGISLSGIMAILFSGIVMSHYTH | 350 | PRIMARY | 23 | 8 | 366 | RTVAFLCETCVFAFLGLSIFSFP | 388 | PRIMARY | 23 | 9 | 395 | FVIWCIVLVLFGRAVNIFPLSYL | 417 | PRIMARY | 23 | 10 | 465 | TTIVIVLFTILLLGGSTMPLIRL | 487 | SECONDARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GTAAAAATGACGAGTGCTGGG |
---|---|
Primer_r | CCAAGAAGAGCAGCACATCAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |