Order Kazusa clone(s) from : ![]() |
Product ID | ORK00690 |
---|---|
Accession No | AB023156 |
Description | solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8, transcript variant 2 |
Clone name | hh04825s1 |
Vector information | |
cDNA sequence | DNA sequence (6087 bp) Predicted protein sequence (595 aa) |
HaloTag ORF Clone |
FHC00690
![]() |
Flexi ORF Clone | FXC00690 |
Source | Human adult brain |
Rouge ID |
mKIAA0939
by Kazusa Mouse cDNA Project
|
Note | We replaced hh04825, former representative clones for KIAA0939 with hh04825s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4299 bp |
---|---|
Genome contig ID | gi51511747f_47762825 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (179356 - 179405) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | f | 47862825 | 47942179 | 16 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR004709 | 139 | 150 | PR01084 | Sodium/hydrogen exchanger subfamily |
IPR004709 | 153 | 167 | PR01084 | Sodium/hydrogen exchanger subfamily | |
IPR004709 | 168 | 176 | PR01084 | Sodium/hydrogen exchanger subfamily | |
IPR004709 | 208 | 218 | PR01084 | Sodium/hydrogen exchanger subfamily | |
HMMPfam | IPR006153 | 76 | 487 | PF00999 | Sodium/hydrogen exchanger |
HMMTigr | IPR004709 | 67 | 590 | TIGR00840 | Sodium/hydrogen exchanger subfamily |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 30 | HEGFNVTLHTTLVVTTKLVLPTP | 52 | SECONDARY | 23 | 2 | 74 | MTIFFSLLVLAICIILVHLLIR | 95 | PRIMARY | 22 | 3 | 102 | PESVAVVSLGILMGAVIKIIEF | 123 | PRIMARY | 22 | 4 | 166 | GSITLFAVFGTAISAFVVGGGIY | 188 | PRIMARY | 23 | 5 | 201 | MTDSFAFGSLISAVDPVATIAIF | 223 | SECONDARY | 23 | 6 | 278 | FLKMFFGSAALGTLTGLISALVL | 300 | SECONDARY | 23 | 7 | 328 | EGISLSGIMAILFSGIVMSHYTH | 350 | PRIMARY | 23 | 8 | 366 | RTVAFLCETCVFAFLGLSIFSFP | 388 | PRIMARY | 23 | 9 | 395 | FVIWCIVLVLFGRAVNIFPLSYL | 417 | PRIMARY | 23 | 10 | 465 | TTIVIVLFTILLLGGSTMPLIRL | 487 | SECONDARY | 23 |
---|
![]() |
Primer_f | GTAAAAATGACGAGTGCTGGG |
---|---|
Primer_r | CCAAGAAGAGCAGCACATCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |