KIAA0943

Product ID	ORK00154
Accession No	AB023160
Description	autophagy related 4B, cysteine peptidase, transcript variant 1
Clone name	bm03784
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (2778 bp) Predicted protein sequence (396 aa)
HaloTag ORF Clone	FHC00154
Flexi ORF Clone	FXC00154
Source	Human adult brain
Rouge ID	mKIAA0943 by Kazusa Mouse cDNA Project
Note	We replaced hh08433, former representative clones for KIAA0943 with bm03784. (2005/08/06)

Length: 2778 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1586 bp
Genome contig ID	gi89161199f_242139095
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCTTAATGGCAAATAATAAGTTTCAGTAGAAAAC
Flanking genome sequence (122849 - 122898)	----+--------+--------+--------+--------+----* AAACCTTGTGTCTATTTTTTCCTTAAGTTCTAATTGAATGTGAGTTCCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	242225793	242261942	13	99.3	Perfect prediction

Length: 396 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG64112	6.3e-184	100.0	unnamed protein...	Homo sapiens
2D1I	3.1e-183	99.7	Structure of hu...	Homo sapiens
Q9Y4P1	1.1e-182	100.0	Cysteine protea...	Homo sapiens
2CY7	1.1e-182	100.0	The crystal str...	Homo sapiens
AAY14919	4.6e-182	99.7	unknown [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005078	39	340	PF03416	Peptidase C54

Primer_f	GTATCCTTTCTCCCTTGGGTG
Primer_r	TCAAAACACACGAGACAAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-