Order Kazusa clone(s) from : ![]() |
Product ID | ORK00707 |
---|---|
Accession No | AB023197 |
Description | ninein-like |
Clone name | hj07083 |
Vector information | |
cDNA sequence | DNA sequence (4848 bp) Predicted protein sequence (1406 aa) |
Flexi ORF Clone | FXC00707 |
Source | Human adult brain |
Rouge ID |
mKIAA0980
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 625 bp |
---|---|
Genome contig ID | gi51511747r_25281462 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 25381462 | 25514153 | 24 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR002048 | 237 | 282 | PD000012 | Calcium-binding EF-hand |
HMMPfam | IPR002048 | 35 | 63 | PF00036 | Calcium-binding EF-hand |
IPR002048 | 261 | 289 | PF00036 | Calcium-binding EF-hand | |
HMMSmart | IPR002048 | 35 | 63 | SM00054 | Calcium-binding EF-hand |
IPR002048 | 224 | 252 | SM00054 | Calcium-binding EF-hand | |
IPR002048 | 261 | 289 | SM00054 | Calcium-binding EF-hand | |
ProfileScan | IPR002048 | 31 | 66 | PS50222 | Calcium-binding EF-hand |
IPR002048 | 84 | 100 | PS50222 | Calcium-binding EF-hand | |
IPR002048 | 220 | 255 | PS50222 | Calcium-binding EF-hand | |
IPR002048 | 257 | 292 | PS50222 | Calcium-binding EF-hand | |
ScanRegExp | IPR002048 | 270 | 282 | PS00018 | Calcium-binding EF-hand |
![]() |
Primer_f | TTTGCCATTTCACTGTTCTGC |
---|---|
Primer_r | AGTCCACAGATAAGGTCCCCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTTGCCATTTCACTGTTCTGC |
Primer_r | AGTCCACAGATAAGGTCCCCG |
PCR product length | 154 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |