KIAA0983

Gene/Protein Characteristic Table for KIAA0983

Order Kazusa clone(s) from :

Product ID	ORK02009
Accession No	AB023200
Description	THO complex 5, transcript variant 4
Clone name	hj07256
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4685 bp) Predicted protein sequence (687 aa)
HaloTag ORF Clone	FHC02009
Flexi ORF Clone	FXC02009
Source	Human adult brain
Rouge ID	mKIAA0983 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4685 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2578 bp
Genome contig ID	gi89161203r_28132147
PolyA signal sequence (None)	+--------+--------+----*----+---- CACCATCTGGACAACAGAGCAAGACTCCGTCTTGG
Flanking genome sequence (99721 - 99672)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGATGTAGAAATGTAAAAATATTTGAGAATTATTACAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	28231868	28279703	20	98.8	Perfect prediction

Features of the protein sequence

Description

Length: 687 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW59807	99.9	hCG2011153, iso...	Homo sapiens
BAG72824	100.0	THO complex 5 [...	synthetic construct
EAW59808	99.9	hCG2011153, iso...	Homo sapiens
Q13769	99.9	THO complex sub...	Homo sapiens
AAX43295	99.9	chromosome 22 o...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GATGCTCACCTCTTGTCTACG
Primer_r	ACAGGACTAATGGGAAGAGCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 22

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp