KIAA1006

Product ID	ORK02011
Accession No	AB023223
Description	syntaxin binding protein 5-like, transcript variant 1
Clone name	hk10084
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4370 bp) Predicted protein sequence (1221 aa)
HaloTag ORF Clone	FHC02011
Flexi ORF Clone	FXC02011
Source	Human adult brain

Length: 4370 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	702 bp
Genome contig ID	gi89161205f_122009773
PolyA signal sequence (AGTAAA,-19)	+--------+--------+----*----+---- CAAATATTGCCAGTATAGTAAATTATTCCCAACAC
Flanking genome sequence (611565 - 611614)	----+--------+--------+--------+--------+----* AATCAGTTTCATTTCTATCACCTTCAGAATGGGTTGCTGTTTTTAGCACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	122109773	122621336	28	100.0	Perfect prediction

Length: 1221 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516678	100.0	syntaxin bindin...	Pan troglodytes
EAW79517	100.0	hCG16779, isofo...	Homo sapiens
Q9Y2K9	100.0	Syntaxin-bindin...	Homo sapiens
XP_001070379	95.0	similar to Synt...	Rattus norvegicus
XP_001500511	97.7	syntaxin bindin...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051432	0.00033	23.9	KIAA1645

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000664	88	106	PR00962	Lethal(2) giant larvae protein
	IPR001680	161	175	PR00320	WD40 repeat
	IPR001680	259	273	PR00320	WD40 repeat
	IPR000664	356	378	PR00962	Lethal(2) giant larvae protein
	IPR000664	408	428	PR00962	Lethal(2) giant larvae protein
	IPR000664	496	519	PR00962	Lethal(2) giant larvae protein
	IPR001680	499	513	PR00320	WD40 repeat
	IPR000664	679	703	PR00962	Lethal(2) giant larvae protein
HMMPfam	IPR001680	287	313	PF00400	WD40 repeat
	IPR013577	320	432	PF08366	Lethal giant larvae homologue 2
	IPR001680	434	512	PF00400	WD40 repeat
HMMSmart	IPR001680	94	133	SM00320	WD40 repeat
	IPR001680	135	174	SM00320	WD40 repeat
	IPR001680	233	272	SM00320	WD40 repeat
	IPR001680	276	313	SM00320	WD40 repeat
	IPR001680	433	512	SM00320	WD40 repeat
	IPR001680	537	577	SM00320	WD40 repeat
ProfileScan	IPR001680	142	183	PS50082	WD40 repeat
	IPR001680	142	322	PS50294	WD40 repeat
	IPR001680	281	322	PS50082	WD40 repeat
	IPR001388	1156	1216	PS50892	Synaptobrevin
ScanRegExp	IPR001680	161	175	PS00678	WD40 repeat
	IPR001680	259	273	PS00678	WD40 repeat
	IPR001680	499	513	PS00678	WD40 repeat

Primer_f	ACGGGGAGTCCTCTTGATTTG
Primer_r	TGAGTGTGGCCCAATTGATAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACGGGGAGTCCTCTTGATTTG
Primer_r	TGAGTGTGGCCCAATTGATAG
PCR product length	176 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles