KIAA1025

Product ID	ORK05956
Accession No	AB028948
Description	mediator complex subunit 13-like
Clone name	fg00971s1
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8444 bp) Predicted protein sequence (1917 aa)
Source	Human fetal brain
Rouge ID	mKIAA1025 by Kazusa Mouse cDNA Project
Note	We replaced fg00971, former representative clones for KIAA1025 with fg00971s1. (2002/5/10)

Length: 8444 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2689 bp
Genome contig ID	gi89161190r_114780766
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACACTTTTTTAGAGGAATAAATTATTGAATTACTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCTTTGAGTGGCTTTTTTCCCTTCCTCTCCTGCCTTTGTATAAAATTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	114880766	114941528	25	99.6	Terminal No-hit

Length: 1917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW98081	99.8	thyroid hormone...	Homo sapiens
Q71F56	99.8	Mediator of RNA...	Homo sapiens
CAH18186	99.7	hypothetical pr...	Homo sapiens
CAB61363	100.0	hypothetical pr...	Homo sapiens
XP_001112106	98.9	similar to thyr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011165	7.9e-125	51.9	KIAA0593

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009401	1015	1612	PF06333	TRAP240

Primer_f	GCTACACTCTGCAAATAACCC
Primer_r	AAGTTTCCAGGTCCATGAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-