KIAA1033

Product ID	ORK01144
Accession No	AB028956
Description	KIAA1033, transcript variant 2
Clone name	fh00728
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5112 bp) Predicted protein sequence (1196 aa)
HaloTag ORF Clone	FHC01144
Flexi ORF Clone	FXC01144
Source	Human fetal brain
Rouge ID	mKIAA1033 by Kazusa Mouse cDNA Project

Length: 5112 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1521 bp
Genome contig ID	gi89161190f_103925640
PolyA signal sequence (None)	+--------+--------+----*----+---- TAATTTATATTTTCATTATTATAAGTGTTTATATT
Flanking genome sequence (160722 - 160771)	----+--------+--------+--------+--------+----* AATGATCTTGCATTTGATTATATCAAATTCGTCATTTCATAGCAACAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	104025640	104086360	33	99.7	Perfect prediction

Length: 1196 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056090	99.9	hypothetical pr...	Homo sapiens
XP_531762	97.7	similar to CG13...	Canis lupus fam...
EDL21392	96.4	mCG3365, isofor...	Mus musculus
XP_235003	95.7	similar to CG13...	Rattus norvegicus
BAE26179	97.0	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CCATAGAGTCCTGTTTGAAGC
Primer_r	AAGTCTACCCAAACCATCACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 12

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CCATAGAGTCCTGTTTGAAGC
Primer_r	AAGTCTACCCAAACCATCACC
PCR product length	154 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles