Order Kazusa clone(s) from : ![]() |
Product ID | ORK00169 |
---|---|
Accession No | AB028963 |
Description | MON2 homolog, regulator of endosome-to-Golgi trafficking, transcript variant 1 |
Clone name | hh15271 |
Vector information | |
cDNA sequence | DNA sequence (6387 bp) Predicted protein sequence (1736 aa) |
HaloTag ORF Clone |
FHC00169
![]() |
Flexi ORF Clone | FXC00169 |
Source | Human adult brain |
Rouge ID |
mKIAA1040
by Kazusa Mouse cDNA Project
|
Note | We replaced fh02456 and fh02456s1, former representative clones for KIAA1040 with hh15271. (2002/5/10,2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 871 bp |
---|---|
Genome contig ID | gi89161190f_61046896 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (226773 - 226822) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 61146896 | 61273667 | 35 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR015403 | 866 | 951 | PF09324 | Protein of unknown function DUF1981 |
IPR000357 | 1159 | 1195 | PF02985 | HEAT |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 571 | MVNACWCGLLAALSLLLDASTDE | 593 | PRIMARY | 23 |
---|
Primer_f | GTTAATTATCCCTCCCATCAG |
---|---|
Primer_r | TTCTTGGCAGCTGTTGTTGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTTAATTATCCCTCCCATCAG |
Primer_r | TTCTTGGCAGCTGTTGTTGGC |
PCR product length | 146 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |