KIAA1048

Product ID	ORK00722
Accession No	AB028971
Description	AP2 associated kinase 1
Clone name	hh02560
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hh02560 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4506 bp) Predicted protein sequence (897 aa)
HaloTag ORF Clone	FHC00722
Flexi ORF Clone	FXC00722
Source	Human adult brain
Rouge ID	mKIAA1048 by Kazusa Mouse cDNA Project

Length: 4506 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1530 bp
Genome contig ID	gi89161199r_69461797
PolyA signal sequence (None)	+--------+--------+----*----+---- TCAGGAGCAAGACACCATCTCAAAAAATGAGAATT
Flanking genome sequence (99895 - 99846)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAGAAAGCTTCACAGAATTTCCTAAAGAAACTTCTGACTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	69561692	69724353	18	99.0	Perfect prediction

Length: 897 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI04843	7.5e-199	100.0	AP2 associated ...	Homo sapiens
Q2M2I8	1.1e-198	99.9	AP2-associated ...	Homo sapiens
EAW99847	3.6e-198	99.9	AP2 associated ...	Homo sapiens
AAI43711	9.5e-198	99.8	Unknown (protei...	Homo sapiens
XP_001138187	1.4e-197	99.5	AP2 associated ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	80	336	PD000001	Protein kinase
HMMPfam	IPR000719	80	344	PF00069	Protein kinase
HMMSmart	IPR001245	80	346	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	80	347	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	80	349	PS50011	Protein kinase
ScanRegExp	IPR008271	206	218	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	275	TKADIWALGCLLYKLCYFTLPF	296	PRIMARY	22

Primer_f	AGATGGATTAATGGCCTTTGC
Primer_r	ACATAAGCCGCTCAGCAAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGATGGATTAATGGCCTTTGC
Primer_r	ACATAAGCCGCTCAGCAAACC
PCR product length	144 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles