Order Kazusa clone(s) from : ![]() |
Product ID | ORK05633 |
---|---|
Accession No | AB029009 |
Description | zinc finger RNA binding protein 2 |
Clone name | hj08218 |
Vector information | |
cDNA sequence | DNA sequence (4635 bp) Predicted protein sequence (902 aa) |
Flexi ORF Clone |
FXC05633
![]() |
Source | Human adult brain |
Rouge ID |
mKIAA1086
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1925 bp |
---|---|
Genome contig ID | gi42406306r_3655022 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 3755022 | 3785924 | 18 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006561 | 621 | 867 | PF07528 | DZF |
HMMSmart | IPR003604 | 231 | 265 | SM00451 | Zinc finger |
IPR015880 | 234 | 258 | SM00355 | Zinc finger | |
IPR003604 | 279 | 313 | SM00451 | Zinc finger | |
IPR015880 | 282 | 306 | SM00355 | Zinc finger | |
IPR003604 | 428 | 462 | SM00451 | Zinc finger | |
IPR015880 | 431 | 455 | SM00355 | Zinc finger | |
IPR006561 | 615 | 867 | SM00572 | DZF | |
ScanRegExp | IPR007087 | 236 | 258 | PS00028 | Zinc finger |
IPR007087 | 284 | 306 | PS00028 | Zinc finger | |
IPR007087 | 433 | 455 | PS00028 | Zinc finger |
![]() |
Primer_f | CAACCTGTTCAAACCTTCCGC |
---|---|
Primer_r | TTCAGACAGAGCCACATGCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAACCTGTTCAAACCTTCCGC |
Primer_r | TTCAGACAGAGCCACATGCAG |
PCR product length | 164 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |