KIAA1100

Product ID	ORK01626
Accession No	AB029023
Description	ring finger protein 44
Clone name	hk07907
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4023 bp) Predicted protein sequence (444 aa)
HaloTag ORF Clone	FHC01626
Flexi ORF Clone	FXC01626
Source	Human adult brain
Rouge ID	mKIAA1100 by Kazusa Mouse cDNA Project

Length: 4023 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2314 bp
Genome contig ID	gi51511721r_175786321
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GAGGGATATTCACTAATAAATGTATGATGTATACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACGACCGCCCACGCTGCCTTTGGCTGCCCGTGTCTTTTTGGTGGGAGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	175886321	175896912	11	99.4	Perfect prediction

Length: 444 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001091221	1.1e-135	98.6	similar to ring...	Macaca mulatta
Q7L0R7	7.7e-134	100.0	RING finger pro...	Homo sapiens
XP_001136577	2.7e-132	99.5	ring finger pro...	Pan troglodytes
XP_001502682	6.6e-127	95.4	similar to RING...	Equus caballus
XP_546217	1.7e-126	96.1	similar to ring...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	392	432	PF00097	Zinc finger
HMMSmart	IPR001841	392	432	SM00184	Zinc finger
ProfileScan	IPR001841	392	433	PS50089	Zinc finger

Primer_f	GCAGCAGTGATTCCAACAAGC
Primer_r	GAGAGTAAACAATGGCAAGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	GCAGCAGTGATTCCAACAAGC
Primer_r	GAGAGTAAACAATGGCAAGCC
PCR product length	177 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles