KIAA1152

Product ID	ORK00750
Accession No	AB032978
Description	G patch domain containing 2-like
Clone name	hh00415
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6256 bp) Predicted protein sequence (354 aa)
HaloTag ORF Clone	FHC00750
Flexi ORF Clone	FXC00750
Source	Human adult brain
Rouge ID	mKIAA1152 by Kazusa Mouse cDNA Project

Length: 6256 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	5132 bp
Genome contig ID	gi51511730f_75588030
PolyA signal sequence (ACTAAA,-11)	+--------+--------+----*----+---- CCAACATGGTGAAACCCTGTCTCTACTAAAAATAC
Flanking genome sequence (128098 - 128147)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAATTAGCTGGGTGTGGTGGTAGGCGCCTGTAATCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	75688030	75716126	6	99.2	Perfect prediction

Length: 354 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH58032	1e-151	100.0	C14orf118 prote...	Homo sapiens
XP_001162316	6.8e-141	100.0	hypothetical pr...	Pan troglodytes
EAW81254	6.8e-141	100.0	chromosome 14 o...	Homo sapiens
Q9NWQ4	6.9e-141	100.0	Uncharacterized...	Homo sapiens
EAW81250	7.1e-141	100.0	chromosome 14 o...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TGGTAGAAGACATAACTGGTG
Primer_r	TTTGCTCAGCTTTGTCCTTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 14

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGGTAGAAGACATAACTGGTG
Primer_r	TTTGCTCAGCTTTGTCCTTAC
PCR product length	160 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles