KIAA1175

Product ID	ORK06259
Accession No	AB033001
Description	phosphofurin acidic cluster sorting protein 1
Clone name	hg02720a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3390 bp) Predicted protein sequence (641 aa)
Source	Human adult brain

Length: 3390 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1462 bp
Genome contig ID	gi51511727f_65643792
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GGTTTTTCATTCAATAAATTGGTGATTTCTTACCG
Flanking genome sequence (124999 - 125048)	----+--------+--------+--------+--------+----* ACTGCCTTGGGCTTCTATGCCCCCTCACTGTGCCACAGGAGCTGCCCAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	65743785	65768789	17	99.4	Terminal No-hit

Length: 641 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW74506	100.0	phosphofurin ac...	Homo sapiens
Q6VY07	100.0	Phosphofurin ac...	Homo sapiens
XP_001170735	99.8	phosphofurin ac...	Pan troglodytes
XP_001170754	99.8	phosphofurin ac...	Pan troglodytes
XP_001170787	99.8	phosphofurin ac...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011174	2.5e-41	55.4	KIAA0602

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TTCCCACCATCTTCCTGAGCA
Primer_r	GCTGGAAGAACTTGATGTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-