KIAA1181

Product ID	ORK02021
Accession No	AB033007
Description	endoplasmic reticulum-golgi intermediate compartment 1
Clone name	hf00712a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2432 bp) Predicted protein sequence (336 aa)
HaloTag ORF Clone	FHC02021
Flexi ORF Clone	FXC02021
Source	Human adult brain
Rouge ID	mKIAA1181 by Kazusa Mouse cDNA Project

Length: 2432 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1420 bp
Genome contig ID	gi51511721f_172093937
PolyA signal sequence (None)	+--------+--------+----*----+---- TCCAGTGGAAGGATTTTTAAAATTATCTTATGGAT
Flanking genome sequence (217910 - 217959)	----+--------+--------+--------+--------+----* AGCTCAAGTCTCTGCCATTTGTAATTTTTGGCTCTAAGCTCCGATTGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	172193884	172311845	10	100.0	Perfect prediction

Length: 336 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001099287	2e-143	99.1	endoplasmic ret...	Macaca mulatta
XP_001063333	9.2e-125	89.4	similar to Endo...	Rattus norvegicus
XP_001066818	5.1e-124	89.1	similar to Endo...	Rattus norvegicus
Q969X5	2.7e-123	100.0	Endoplasmic ret...	Homo sapiens
XP_001499596	5.7e-123	89.6	similar to Endo...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012936	131	333	PF07970	Protein of unknown function DUF1692

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	72	AIISICCCLFILFLFLSELTGFI	94	PRIMARY	23

Primer_f	TAATCATGCAGCCTCTCAGAC
Primer_r	ATGGAGGAGCACAGTGTCAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TAATCATGCAGCCTCTCAGAC
Primer_r	ATGGAGGAGCACAGTGTCAAG
PCR product length	174 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles