KIAA1196

Product ID	ORK07484
Accession No	AB033022
Description	zinc finger protein 512B
Clone name	fg01776
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5742 bp) Predicted protein sequence (851 aa)
Source	Human fetal brain
Rouge ID	mKIAA1196 by Kazusa Mouse cDNA Project

Length: 5742 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3185 bp
Genome contig ID	gi51511747r_61958511
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GACTGTATCAAATAAATGTTTATTGATTTTTTTCC
Flanking genome sequence (99991 - 99942)	----+--------+--------+--------+--------+----* AGGGTTTTTGTGCGGCTCAGTTTGTGGTGAAAAACAGGGGGCGGGGCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	62058502	62069319	15	99.4	Perfect prediction

Length: 851 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96KM6	100.0	Zinc finger pro...	Homo sapiens
EAW75182	99.3	hCG2040175, iso...	Homo sapiens
XP_525391	99.5	similar to RP4-...	Pan troglodytes
XP_001113501	97.4	hypothetical pr...	Macaca mulatta
XP_001915499	88.5	similar to Zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058708	9.7e-31	41.5	KIAA1805

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR004829	130	185	PD153432	Cell surface antigen
HMMPfam	IPR007087	99	122	PF00096	Zinc finger
	IPR007087	499	522	PF00096	Zinc finger
	IPR007087	589	612	PF00096	Zinc finger
	IPR007087	743	766	PF00096	Zinc finger
HMMSmart	IPR015880	64	86	SM00355	Zinc finger
	IPR015880	99	122	SM00355	Zinc finger
	IPR015880	499	522	SM00355	Zinc finger
	IPR015880	553	575	SM00355	Zinc finger
	IPR015880	589	612	SM00355	Zinc finger
	IPR015880	743	766	SM00355	Zinc finger
ProfileScan	IPR007087	99	126	PS50157	Zinc finger
	IPR007087	499	527	PS50157	Zinc finger
	IPR007087	589	617	PS50157	Zinc finger
	IPR007087	743	767	PS50157	Zinc finger
ScanRegExp	IPR007087	101	122	PS00028	Zinc finger
	IPR007087	501	522	PS00028	Zinc finger
	IPR007087	591	612	PS00028	Zinc finger
	IPR007087	745	766	PS00028	Zinc finger

Primer_f	AGTGAGAGGGACCAGCATAGC
Primer_r	AGTGCATCCCATTTTCGTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGTGAGAGGGACCAGCATAGC
Primer_r	AGTGCATCCCATTTTCGTGTG
PCR product length	184 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles