KIAA1226

Product ID	ORK02022
Accession No	AB033052
Description	neurolysin (metallopeptidase M3 family)
Clone name	fh04414s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1617) was subcloned upstream of the cDNA (1618-6113). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGGG CCGCGGGAAT TCGATT-5' end of cDNA.
cDNA sequence	DNA sequence (6113 bp) Predicted protein sequence (704 aa)
HaloTag ORF Clone	FHC02022
Flexi ORF Clone	FXC02022
Source	Human fetal brain
Rouge ID	mKIAA1226 by Kazusa Mouse cDNA Project
Note	We replaced fh04414, former representative clones for KIAA1226 with fh04414s1. (2002/5/10)

Length: 6113 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3998 bp
Genome contig ID	gi51511721f_64953957
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- GCCTGGGTGACAGAGACCCTGTCTTAAAATAAAAT
Flanking genome sequence (204540 - 204589)	----+--------+--------+--------+--------+----* AAAAAAAAAAGGAAAAGGAAAGACATACATACCCTCAGTTCTTCGAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	65053957	65158495	13	99.3	Perfect prediction

Length: 704 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF85492	99.9	unnamed protein...	Homo sapiens
XP_001163138	99.1	neurolysin isof...	Pan troglodytes
Q5R9V6	98.3	Neurolysin, mit...	Pongo abelii
XP_001087239	98.3	similar to neur...	Macaca mulatta
XP_001163103	99.1	neurolysin isof...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001567	251	701	PF01432	Peptidase M3A and M3B
ScanRegExp	IPR006025	494	503	PS00142	Peptidase M

Primer_f	TAGAGAGCCATGGGAAGAGAG
Primer_r	ATCACCAGACAGAACAGGCTA
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-