KIAA1227

Product ID	ORK00773
Accession No	AB033053
Description	zinc finger and BTB domain containing 21, transcript variant 2
Clone name	fh04710
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5561 bp) Predicted protein sequence (1069 aa)
HaloTag ORF Clone	FHC00773
Flexi ORF Clone	FXC00773
Source	Human fetal brain
Rouge ID	mKIAA1227 by Kazusa Mouse cDNA Project

Length: 5561 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2257 bp
Genome contig ID	gi51511750r_42181816
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATATAAGATTTCAAATAAAATTTTGAACCAAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTATAATGCCGTTCTGGTTTTTCTATTACTTTTTATACTGTACTTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	21	r	42281816	42303519	2	99.0	Perfect prediction

Length: 1069 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULJ3	100.0	Zinc finger pro...	Homo sapiens
AAH63290	99.9	Zinc finger pro...	Homo sapiens
XP_514917	99.7	zinc finger pro...	Pan troglodytes
XP_001106447	99.2	similar to zinc...	Macaca mulatta
XP_001493007	90.1	zinc finger pro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	23	129	PF00651	BTB/POZ
	IPR007087	549	572	PF00096	Zinc finger
	IPR007087	673	695	PF00096	Zinc finger
	IPR007087	912	935	PF00096	Zinc finger
	IPR007087	940	962	PF00096	Zinc finger
	IPR007087	1046	1068	PF00096	Zinc finger
HMMSmart	IPR000210	33	129	SM00225	BTB/POZ-like
	IPR015880	549	572	SM00355	Zinc finger
	IPR015880	578	601	SM00355	Zinc finger
	IPR015880	673	695	SM00355	Zinc finger
	IPR015880	725	745	SM00355	Zinc finger
	IPR015880	751	771	SM00355	Zinc finger
	IPR015880	778	801	SM00355	Zinc finger
	IPR015880	912	932	SM00355	Zinc finger
	IPR015880	940	962	SM00355	Zinc finger
	IPR015880	1046	1068	SM00355	Zinc finger
ProfileScan	IPR000210	33	99	PS50097	BTB/POZ-like
	IPR007087	549	577	PS50157	Zinc finger
	IPR007087	673	700	PS50157	Zinc finger
	IPR007087	778	806	PS50157	Zinc finger
	IPR007087	912	939	PS50157	Zinc finger
	IPR007087	940	967	PS50157	Zinc finger
	IPR007087	1046	1069	PS50157	Zinc finger
ScanRegExp	IPR007087	551	572	PS00028	Zinc finger
	IPR007087	580	601	PS00028	Zinc finger
	IPR007087	675	695	PS00028	Zinc finger
	IPR007087	780	801	PS00028	Zinc finger
	IPR007087	942	962	PS00028	Zinc finger
	IPR007087	1048	1068	PS00028	Zinc finger

Primer_f	TTACTTCCAGATAGAGCAGAG
Primer_r	AGCAATGATGTAGAGAATGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTACTTCCAGATAGAGCAGAG
Primer_r	AGCAATGATGTAGAGAATGGC
PCR product length	175 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles