KIAA1271

Product ID	ORK02026
Accession No	AB033097
Description	mitochondrial antiviral signaling protein, transcript variant 1
Clone name	hk06527
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4187 bp) Predicted protein sequence (542 aa)
HaloTag ORF Clone	FHC02026
Flexi ORF Clone	FXC02026
Source	Human adult brain
Rouge ID	mKIAA1271 by Kazusa Mouse cDNA Project

Length: 4187 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2486 bp
Genome contig ID	gi51511747f_3683203
PolyA signal sequence (None)	+--------+--------+----*----+---- GCTCCAGCCTGGGCGACAGAGTGGTATTCTGTTTC
Flanking genome sequence (114079 - 114128)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGGCAGTATGTAGCCCCGAAGACTGTTGCCCAAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	3783201	3797280	6	99.2	Terminal No-hit

Length: 542 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7Z434	3.8e-155	100.0	Mitochondrial a...	Homo sapiens
AAH44952	2.4e-154	99.4	Virus-induced s...	Homo sapiens
BAC77356	3e-154	99.4	putative NFkB a...	Homo sapiens
XP_525410	1.9e-153	98.9	virus-induced s...	Pan troglodytes
ABG67965	1.5e-138	90.2	virus-induced s...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	516	GALWLQVAVTGVLVVTLLVVLY	537	PRIMARY	22

Primer_f	ATGGAGGATATAGGGCGTTTC
Primer_r	AAAGAACCCATAAGGATACCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATGGAGGATATAGGGCGTTTC
Primer_r	AAAGAACCCATAAGGATACCC
PCR product length	134 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles