KIAA1279

Product ID	ORK00795
Accession No	AB033105
Description	KIAA1279 (KIAA1279)
Clone name	hh00842s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (2463 bp) Predicted protein sequence (632 aa)
HaloTag ORF Clone	FHC00795
Flexi ORF Clone	FXC00795
Source	Human adult brain
Rouge ID	mKIAA1279 by Kazusa Mouse cDNA Project
Note	We replaced hh00842, former representative clones for KIAA1279 with hh00842s1. (2002/5/10)

Length: 2463 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	562 bp
Genome contig ID	gi89161187f_70318560
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TTAGAAATAAAATAAACTGACTTATTTCACTAATG
Flanking genome sequence (128182 - 128231)	----+--------+--------+--------+--------+----* AAAACTTCTGTTTCCTTTTTGTTTTCTTGTGAGCACTGATACCTCAATAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	70418560	70446740	7	99.2	Perfect prediction

Length: 632 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF84032	99.4	unnamed protein...	Homo sapiens
XP_536374	94.8	similar to CG14...	Canis lupus fam...
XP_001503692	95.8	similar to KIF1...	Equus caballus
XP_001928845	93.7	similar to KIF1...	Sus scrofa
Q6ZPU9	91.8	KIF1-binding pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	ACATTGAGGAAAGCCAGGCAG
Primer_r	ACTTGTATGGTTCCTTCTCCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 10

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ACATTGAGGAAAGCCAGGCAG
Primer_r	ACTTGTATGGTTCCTTCTCCG
PCR product length	135 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles