KIAA1290

Product ID	ORK00798
Accession No	AB033116
Description	oxoglutarate dehydrogenase-like, transcript variant 1
Clone name	hj00086s2
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-77) was subcloned upstream of the cDNA (78-3622). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CGGTATCGAT AAGCTTGATT-5' end of cDNA
cDNA sequence	DNA sequence (3622 bp) Predicted protein sequence (1011 aa)
Flexi ORF Clone	FXC00798
Source	Human adult brain
Note	We replaced hj00086 and hj00086s1, former representative clones for KIAA1290 with hj00086s2. (2002/12/27,2003/4/2)

Length: 3622 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	584 bp
Genome contig ID	gi89161187r_50512696
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACCAAATCACAGAGAAATAAAAACATGCTTCAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATTTGCTGTTTTCATTTCATGTTGTAAAACTGGGGGAGGGATAGGCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	50612696	50636649	22	99.7	Perfect prediction

Length: 1011 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULD0	100.0	2-oxoglutarate ...	Homo sapiens
BAF82915	99.9	unnamed protein...	Homo sapiens
BAA91855	99.8	unnamed protein...	Homo sapiens
AAH26320	99.8	Oxoglutarate de...	Homo sapiens
CAH91542	98.9	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046850	6.8e-88	39.7	KIAA1630

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001017	244	570	PF00676	Dehydrogenase
HMMPfam	IPR005475	637	853	PF02779	Transketolase
HMMTigr	IPR011603	44	1001	TIGR00239	2-oxoglutarate dehydrogenase

Primer_f	CGGCTTCTCCACCTGTATCTC
Primer_r	GCTTCACCTGGCTGTTACTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CGGCTTCTCCACCTGTATCTC
Primer_r	GCTTCACCTGGCTGTTACTGC
PCR product length	175 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles