KIAA1291

Product ID	ORK01157
Accession No	AB033117
Description	exportin 5
Clone name	fh18869
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5296 bp) Predicted protein sequence (1254 aa)
HaloTag ORF Clone	FHC01157
Flexi ORF Clone	FXC01157
Source	Human fetal brain
Rouge ID	mKIAA1291 by Kazusa Mouse cDNA Project
Note	We replaced hj08227, former representative clones for KIAA1291 with fh18869. (2002/5/10)

Length: 5296 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1531 bp
Genome contig ID	gi89161210r_43498053
PolyA signal sequence (AGTAAA,-24)	+--------+--------+----*----+---- ATCTGCATGTCAGTAAAAATCTCAGTTTCGTACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGGGACCCATCTGCCTTTTTCAACCTAGTCTTAAAACCAGTGACATAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	43598053	43651729	32	99.9	Perfect prediction

Length: 1254 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11300	100.0	exportin-5 [syn...	synthetic construct
Q9HAV4	99.9	Exportin-5; Sho...	Homo sapiens
BAF84141	99.8	unnamed protein...	Homo sapiens
AAG53603	99.8	RANBP21 [Homo s...	Homo sapiens
CAI42640	99.6	exportin 5 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013598	159	321	PF08389	Exportin-1/Importin-beta-like

Primer_f	TACCCTAGATAGTGTCACATG
Primer_r	ACCTGAAAGACCATGAGATTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-