Order Kazusa clone(s) from : ![]() |
Product ID | ORK01157 |
---|---|
Accession No | AB033117 |
Description | exportin 5 |
Clone name | fh18869 |
Vector information | |
cDNA sequence | DNA sequence (5296 bp) Predicted protein sequence (1254 aa) |
HaloTag ORF Clone |
FHC01157
![]() |
Flexi ORF Clone | FXC01157 |
Source | Human fetal brain |
Rouge ID |
mKIAA1291
by Kazusa Mouse cDNA Project
|
Note | We replaced hj08227, former representative clones for KIAA1291 with fh18869. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1531 bp |
---|---|
Genome contig ID | gi89161210r_43498053 |
PolyA signal sequence (AGTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 43598053 | 43651729 | 32 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TACCCTAGATAGTGTCACATG |
---|---|
Primer_r | ACCTGAAAGACCATGAGATTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |