KIAA1310

Gene/Protein Characteristic Table for KIAA1310

Order Kazusa clone(s) from :

Product ID	ORK00212
Accession No	AB037731
Description	KAT8 regulatory NSL complex subunit 3
Clone name	fh10589
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5028 bp) Predicted protein sequence (794 aa)
Flexi ORF Clone	FXC00212
Source	Human fetal brain
Rouge ID	mKIAA1310 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5028 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2586 bp
Genome contig ID	gi89161199r_96522638
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TTACATTAACAAAAACAATTAAAAACACCAAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATTTGGATTGCTTCAGCTTCTTTTCAGTTGACTTCTCATATGTATTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	96622638	96667795	21	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 794 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001150109	1.4e-207	96.0	similar to FLJ1...	Pan troglodytes
XP_851544	2.6e-207	93.8	similar to CG82...	Canis lupus fam...
XP_515632	2.1e-206	96.7	similar to FLJ1...	Pan troglodytes
XP_001149512	2.1e-206	96.7	similar to FLJ1...	Pan troglodytes
CAL37956	6.5e-206	96.5	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AACTTGCACAGGGTAACAGAG
Primer_r	ACATCTCCATAGGGCATCAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 2

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp