KIAA1387

Product ID	ORK00820
Accession No	AB037808
Description	protein phosphatase 4, regulatory subunit 3B, transcript variant 1
Clone name	fj06480
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4385 bp) Predicted protein sequence (950 aa)
HaloTag ORF Clone	FHC00820
Flexi ORF Clone	FXC00820
Source	Human fetal brain
Rouge ID	mKIAA1387 by Kazusa Mouse cDNA Project

Length: 4385 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1532 bp
Genome contig ID	gi89161199r_55529019
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- AAAATTCAGGAATTAAAATGTGACCCTGTAATTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATAATTGATGTTTGTGTTTGGTTTGTTGTAAATATAAATTAACTCCATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	55629019	55698227	17	99.7	Perfect prediction

Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_001116436	0	99.9	SMEK homolog 2,...	Homo sapiens
XP_001112386	0	91.8	similar to fala...	Macaca mulatta
BAG59121	0	99.4	unnamed protein...	Homo sapiens
XP_531833	2e-211	92.6	similar to CG93...	Canis lupus fam...
XP_001496215	4.4e-186	87.5	SMEK homolog 2,...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095930	4.1e-140	71.8	KIAA2010

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006887	267	460	PF04802	Protein of unknown function DUF625

Primer_f	TTGTCAACCGCCTACCAGTAC
Primer_r	GCACTATTCTTGGTTGGTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTGTCAACCGCCTACCAGTAC
Primer_r	GCACTATTCTTGGTTGGTCTG
PCR product length	134 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles