KIAA1392

Product ID	ORK00823
Accession No	AB037813
Description	storkhead box 2
Clone name	hj05048
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4654 bp) Predicted protein sequence (950 aa)
HaloTag ORF Clone	FHC00823
Flexi ORF Clone	FXC00823
Source	Human adult brain
Rouge ID	mKIAA1392 by Kazusa Mouse cDNA Project

Length: 4654 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	438 bp
Genome contig ID	gi89161207f_184963503
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAAAAAAAAAAAACAAAACAAAACAAAAAAAATT
Flanking genome sequence (212368 - 212417)	----+--------+--------+--------+--------+----* TAAAAAAAAAAAACAAAAAACAAAACTAAGCTACCACGAAATGTCAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	185063503	185175869	4	100.0	Perfect prediction

Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_526749	100.0	storkhead box 2...	Pan troglodytes
Q9P2F5	100.0	Storkhead-box p...	Homo sapiens
Q95K63	98.7	Storkhead-box p...	Macaca fascicularis
XP_001082148	98.7	similar to stor...	Macaca mulatta
XP_001491976	96.9	storkhead box 2...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CTGAGCACACATAGGAAAGTC
Primer_r	AAGTGTCAAGGATCAGTTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 4

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTGAGCACACATAGGAAAGTC
Primer_r	AAGTGTCAAGGATCAGTTCTG
PCR product length	148 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles