KIAA1395

Product ID	ORK01688
Accession No	AB037816
Description	dedicator of cytokinesis 6
Clone name	hj07927s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6356 bp) Predicted protein sequence (2051 aa)
HaloTag ORF Clone	FHC01688
Flexi ORF Clone	FXC01688
Source	Human adult brain
Rouge ID	mKIAA1395 by Kazusa Mouse cDNA Project
Note	We replaced hj07927, former representative clones for KIAA1395 with hj07927s1. (2002/12/27)

Length: 6356 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	200 bp
Genome contig ID	gi42406306r_11070973
PolyA signal sequence (None)	+--------+--------+----*----+---- CCTCCCTTTTTTAATTTAAAATGGTTTTTATAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCTGTGCCATGTGGTGCGGTCACTAGGGGCTGGGTCACATGCTCATCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	11170973	11234128	47	99.6	Perfect prediction

Length: 2051 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96HP0	100.0	Dedicator of cy...	Homo sapiens
NP_065863	100.0	dedicator of cy...	Homo sapiens
EAW84184	99.1	dedicator of cy...	Homo sapiens
XP_001916401	92.5	dedicator of cy...	Equus caballus
EAW84182	99.6	dedicator of cy...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051558	0	66.3	KIAA1771
AB028981	9.8e-32	30.6	KIAA1058
AB018259	3.1e-07	22.4	KIAA0716
D86964	1.1e-05	24.7	KIAA0209

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010703	1843	2022	PF06920	Dedicator of cytokinesis

Primer_f	GCAGGTCACCATGTCTCTCTC
Primer_r	GTCAGGATCATGTGCAGGTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCAGGTCACCATGTCTCTCTC
Primer_r	GTCAGGATCATGTGCAGGTTG
PCR product length	177 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles