KIAA1417

Product ID	ORK05478
Accession No	AB037838
Description	inhibitor of Bruton agammaglobulinemia tyrosine kinase, transcript variant 1
Clone name	fh14782
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5522 bp) Predicted protein sequence (1379 aa)
Source	Human fetal brain
Rouge ID	mKIAA1417 by Kazusa Mouse cDNA Project
Note	We replaced hh15303, former representative clones for KIAA1417 with fh14782. (2002/5/10)

Length: 5522 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1186 bp
Genome contig ID	gi89161210r_82836675
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CAGATGTGCAATAAAAAATGATCTTGATCCATTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTAATGTGTGCTTGACATTTTTTACTATATTGACATTTATTATGGAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	82936675	83007156	28	99.9	Terminal No-hit

Length: 1379 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2D0	100.0	Inhibitor of Br...	Homo sapiens
XP_518606	99.4	inhibitor of Br...	Pan troglodytes
XP_001914988	91.7	similar to Inhi...	Equus caballus
XP_539018	91.1	similar to inhi...	Canis lupus fam...
XP_613576	90.5	similar to Inhi...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046813	2.7e-07	31.7	KIAA1593
AB040903	2.2e-06	27.9	KIAA1470
D25215	2.3e-05	30.7	KIAA0032
AB082526	0.00033	27.9	KIAA1995

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	112	124	PR01415	Ankyrin
FPrintScan	IPR002110	124	136	PR01415	Ankyrin
HMMPfam	IPR002110	77	109	PF00023	Ankyrin
	IPR002110	111	143	PF00023	Ankyrin
	IPR000408	221	270	PF00415	Regulator of chromosome condensation
	IPR000408	273	325	PF00415	Regulator of chromosome condensation
	IPR013069	580	714	PF00651	BTB/POZ
	IPR013069	783	897	PF00651	BTB/POZ
HMMSmart	IPR002110	77	106	SM00248	Ankyrin
	IPR002110	111	140	SM00248	Ankyrin
	IPR000210	590	770	SM00225	BTB/POZ-like
	IPR000210	794	897	SM00225	BTB/POZ-like
ProfileScan	IPR002110	77	109	PS50088	Ankyrin
	IPR002110	77	161	PS50297	Ankyrin
	IPR002110	111	143	PS50088	Ankyrin
	IPR000408	168	221	PS50012	Regulator of chromosome condensation
	IPR000408	222	273	PS50012	Regulator of chromosome condensation
	IPR000408	274	328	PS50012	Regulator of chromosome condensation
	IPR000210	590	670	PS50097	BTB/POZ-like
	IPR000210	794	862	PS50097	BTB/POZ-like

Primer_f	AGCATTCTGGAAGCGTATCTC
Primer_r	ACTACATCTCCTTTACTCTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-