KIAA1439

Product ID	ORK00836
Accession No	AB037860
Description	nuclear factor I/A, transcript variant 1
Clone name	hg01641b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of SacI site to KpnI site of the vector.
cDNA sequence	DNA sequence (3063 bp) Predicted protein sequence (561 aa)
HaloTag ORF Clone	FHC00836
Flexi ORF Clone	FXC00836
Source	Human adult brain
Rouge ID	mKIAA1439 by Kazusa Mouse cDNA Project

Length: 3063 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1049 bp
Genome contig ID	gi89161185f_61220568
PolyA signal sequence (None)	+--------+--------+----*----+---- TATTGTTAAACTTGTATCCCTTTAAAAACTGAAGG
Flanking genome sequence (474063 - 474112)	----+--------+--------+--------+--------+----* AAATTAAAAAAAAAAAACAAAAAAACAAATCTAATGGTGCTTTTACCACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	61320568	61694629	11	100.0	Perfect prediction

Length: 561 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG61515	8.1e-150	99.2	unnamed protein...	Homo sapiens
EDL30906	1.1e-148	95.9	nuclear factor ...	Mus musculus
Q12857	4.7e-146	100.0	Nuclear factor ...	Homo sapiens
P09414	7e-146	99.8	Nuclear factor ...	Rattus norvegicus
BAG61351	1.1e-145	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003619	117	224	PF03165	MAD homology 1
HMMPfam	IPR000647	266	561	PF00859	CTF/NF-I
HMMSmart	IPR003619	119	227	SM00523	MAD homology 1
ProfileScan	IPR000647	53	246	PS51080	CTF/NF-I
ScanRegExp	IPR000647	88	99	PS00349	CTF/NF-I

Primer_f	AATATCCCTCAACAGACACAG
Primer_r	CGCTGATAGTGAAGTTGTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-