KIAA1443

Product ID	ORK00839
Accession No	AB037864
Description	homeobox and leucine zipper encoding
Clone name	hj01820b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of SacI site to KpnI site of the vector.
cDNA sequence	DNA sequence (3239 bp) Predicted protein sequence (573 aa)
HaloTag ORF Clone	FHC00839
Flexi ORF Clone	FXC00839
Source	Human adult brain
Rouge ID	mKIAA1443 by Kazusa Mouse cDNA Project

Length: 3239 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1515 bp
Genome contig ID	gi51511730r_22713109
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TAAAATGCTAGAATAATAATAAAAAGGCCAAAAAT
Flanking genome sequence (211893 - 211844)	----+--------+--------+--------+--------+----* GCGGGTGCAGCTGCTGCATTCCCAGGTGAGGGGGTCAGGAGCCACCTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	22811186	22825076	3	98.2	Terminal No-hit

Length: 573 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001150591	2.9e-176	98.6	homeodomain leu...	Pan troglodytes
XP_001102279	4.3e-172	97.0	similar to home...	Macaca mulatta
BAG10069	2e-171	100.0	homeobox and le...	synthetic construct
BAG59479	3.3e-170	99.6	unnamed protein...	Homo sapiens
BAG63992	1.2e-165	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001356	383	437	PF00046	Homeobox
HMMSmart	IPR001356	79	141	SM00389	Homeobox
HMMSmart	IPR001356	380	442	SM00389	Homeobox
ProfileScan	IPR001356	94	133	PS50071	Homeobox
ProfileScan	IPR001356	378	438	PS50071	Homeobox

Primer_f	CCTGTTAACTACCTCCTGTCC
Primer_r	ATTTGCCATATAGCTGATCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCTGTTAACTACCTCCTGTCC
Primer_r	ATTTGCCATATAGCTGATCCC
PCR product length	196 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles