KIAA1486

Product ID	ORK00849
Accession No	AB040919
Description	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
Clone name	fj07162
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4498 bp) Predicted protein sequence (677 aa)
HaloTag ORF Clone	FHC00849
Flexi ORF Clone	FXC00849
Source	Human fetal brain
Rouge ID	mKIAA1486 by Kazusa Mouse cDNA Project

Length: 4498 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2453 bp
Genome contig ID	gi89161199f_225881823
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGTGACAGAGCGAGACTCCATCTC
Flanking genome sequence (345157 - 345206)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAAAAAGAAAAAAAAACTTATTAAAAGTCCTTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	225973935	226226978	6	99.3	Perfect prediction

Length: 677 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001099979	3e-203	98.2	similar to myos...	Macaca mulatta
NP_065915	5.3e-199	99.8	hypothetical pr...	Homo sapiens
EAW70836	8.4e-199	100.0	hCG1811893 [Hom...	Homo sapiens
BAC33918	1.3e-182	91.6	unnamed protein...	Mus musculus
XP_237329	6.5e-179	91.6	similar to myos...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020672	6.3e-21	43.4	KIAA0865

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AGTTCAGAGCCTAAAGTAAGC
Primer_r	ACGATTGGCTAACGATGATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTTGCTCTGATGTTCGTTTGG
Primer_r	TCCAGAATGACACCACCCTAC
PCR product length	187 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles