Order Kazusa clone(s) from : ![]() |
Product ID | ORK00858 |
---|---|
Accession No | AB040971 |
Description | zinc finger and BTB domain containing 4, transcript variant 1 |
Clone name | fg06773 |
Vector information | |
cDNA sequence | DNA sequence (5851 bp) Predicted protein sequence (1029 aa) |
HaloTag ORF Clone |
FHC00858
![]() |
Flexi ORF Clone | FXC00858 |
Source | Human fetal brain |
Rouge ID |
mKIAA1538
by Kazusa Mouse cDNA Project
|
Note | We replaced hk07166, former representative clones for KIAA1538 with fg06773. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2559 bp |
---|---|
Genome contig ID | gi51511734r_7203423 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 7303423 | 7323668 | 4 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 36 | 194 | PF00651 | BTB/POZ |
IPR007087 | 250 | 272 | PF00096 | Zinc finger | |
IPR007087 | 325 | 347 | PF00096 | Zinc finger | |
IPR007087 | 381 | 404 | PF00096 | Zinc finger | |
IPR007087 | 742 | 764 | PF00096 | Zinc finger | |
IPR007087 | 781 | 803 | PF00096 | Zinc finger | |
HMMSmart | IPR000210 | 46 | 203 | SM00225 | BTB/POZ-like |
IPR015880 | 250 | 270 | SM00355 | Zinc finger | |
IPR015880 | 325 | 347 | SM00355 | Zinc finger | |
IPR015880 | 353 | 375 | SM00355 | Zinc finger | |
IPR015880 | 381 | 404 | SM00355 | Zinc finger | |
IPR015880 | 742 | 764 | SM00355 | Zinc finger | |
IPR015880 | 781 | 803 | SM00355 | Zinc finger | |
ProfileScan | IPR000210 | 46 | 168 | PS50097 | BTB/POZ-like |
IPR007087 | 250 | 278 | PS50157 | Zinc finger | |
IPR007087 | 325 | 352 | PS50157 | Zinc finger | |
IPR007087 | 353 | 380 | PS50157 | Zinc finger | |
IPR007087 | 381 | 404 | PS50157 | Zinc finger | |
IPR007087 | 742 | 769 | PS50157 | Zinc finger | |
IPR007087 | 781 | 808 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 327 | 347 | PS00028 | Zinc finger |
IPR007087 | 355 | 375 | PS00028 | Zinc finger | |
IPR007087 | 383 | 404 | PS00028 | Zinc finger | |
IPR007087 | 744 | 764 | PS00028 | Zinc finger | |
IPR007087 | 783 | 803 | PS00028 | Zinc finger |
![]() |
Primer_f | GCCGCAGCACGCAAAATTTAG |
---|---|
Primer_r | TTGGCCTACAGAGTTGGACAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCCGCAGCACGCAAAATTTAG |
Primer_r | TTGGCCTACAGAGTTGGACAC |
PCR product length | 122 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |