KIAA1543

Product ID	ORK05673
Accession No	AB040976
Description	calmodulin regulated spectrin-associated protein family, member 3
Clone name	hh05613a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2800 bp) Predicted protein sequence (917 aa)
Source	Human adult brain
Rouge ID	mKIAA1543 by Kazusa Mouse cDNA Project

Length: 2800 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	46 bp
Genome contig ID	gi42406306f_7481765
PolyA signal sequence (None)	+--------+--------+----*----+---- CGGTCCACGGGCCGGGCCCTGTGTGCTGCGGCCGC
Flanking genome sequence (107226 - 107275)	----+--------+--------+--------+--------+----* CATCCCCTGGAGGACAGTCAGTCGGTATTCCTGGGTCCTGTCTGTCCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	7581765	7588989	10	100.0	Perfect prediction

Length: 917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW69026	100.0	hCG2004001, iso...	Homo sapiens
EAW69025	100.0	hCG2004001, iso...	Homo sapiens
XP_001090322	97.6	hypothetical pr...	Macaca mulatta
XP_001090205	97.6	hypothetical pr...	Macaca mulatta
CAD38783	100.0	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029001	1.2e-15	35.4	KIAA1078

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014797	776	905	PF08683	Protein of unknown function DUF1781

Primer_f	GTCAGGTCTCATGTCCCCAAG
Primer_r	AAGAGGATCAGGAAGTGGTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-