|
Order Kazusa clone(s) from : |
| Product ID | ORK05326 |
|---|---|
| Accession No | AB046780 |
| Description | glycerol-3-phosphate acyltransferase, mitochondrial |
| Clone name | fh19959 |
| Vector information | |
| cDNA sequence | DNA sequence (5674 bp) Predicted protein sequence (662 aa) |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1560
by Kazusa Mouse cDNA Project
|
Length: 5674 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 3685 bp |
|---|---|
| Genome contig ID | gi89161187r_113799614 |
| PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 10 | r | 113899614 | 113923508 | 16 | 99.3 | Perfect prediction |
Length: 662 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR002123 | 39 | 189 | PF01553 | Phospholipid/glycerol acyltransferase |
| HMMSmart | IPR002123 | 58 | 191 | SM00563 | Phospholipid/glycerol acyltransferase |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 9 | QEMVATVSPAMIRLTGWVLLKLF | 31 | SECONDARY | 23 | 2 | 408 | NGVLHVFIMEAIIACSLYAVLN | 429 | PRIMARY | 22 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | GGAGCACCAGCAGTTTATCAC |
|---|---|
| Primer_r | TGTGGCACTCTCAGCATATAC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 10
Experimental conditions| Panel name | unigene |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |