Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05326 |
---|---|
Accession No | AB046780 |
Description | glycerol-3-phosphate acyltransferase, mitochondrial |
Clone name | fh19959 |
Vector information | |
cDNA sequence | DNA sequence (5674 bp) Predicted protein sequence (662 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1560
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3685 bp |
---|---|
Genome contig ID | gi89161187r_113799614 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 113899614 | 113923508 | 16 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002123 | 39 | 189 | PF01553 | Phospholipid/glycerol acyltransferase |
HMMSmart | IPR002123 | 58 | 191 | SM00563 | Phospholipid/glycerol acyltransferase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 9 | QEMVATVSPAMIRLTGWVLLKLF | 31 | SECONDARY | 23 | 2 | 408 | NGVLHVFIMEAIIACSLYAVLN | 429 | PRIMARY | 22 |
---|
RT-PCR-ELISA |
Primer_f | GGAGCACCAGCAGTTTATCAC |
---|---|
Primer_r | TGTGGCACTCTCAGCATATAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |