KIAA1569

Product ID	ORK04535
Accession No	AB046789
Description	centrosomal protein 192kDa
Clone name	fh22407
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5140 bp) Predicted protein sequence (1140 aa)
Source	Human fetal brain
Rouge ID	mKIAA1569 by Kazusa Mouse cDNA Project

Length: 5140 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	264 bp
Genome contig ID	gi51511735f_12947583
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATTATGATATTCTGAATAAATATGGAATATATTTT
Flanking genome sequence (167452 - 167501)	----+--------+--------+--------+--------+----* AATGTGGTATATCCAGAAATTTTTCAGTGAGCTTGTCTTTTTCTATGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	13046679	13115033	26	100.0	Perfect prediction

Length: 1140 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TEP8	99.8	Centrosomal pro...	Homo sapiens
EAX01525	99.6	hCG38274, isofo...	Homo sapiens
AAI44482	99.4	CEP192 protein ...	Homo sapiens
BAB84900	99.3	FLJ00145 protei...	Homo sapiens
AAI44481	99.3	CEP192 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TATCAAGGTCCCAGAACAAGG
Primer_r	ATACTGAGGTCCAAATGGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 18

Experimental conditions

Panel name	CCR
Primer_f	TATCAAGGTCCCAGAACAAGG
Primer_r	ATACTGAGGTCCAAATGGCTG
PCR product length	"166(2.0,250)" bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles