KIAA1601

Product ID	ORK06897
Accession No	AB046821
Description	sarcolemma associated protein
Clone name	fj10228
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3851 bp) Predicted protein sequence (690 aa)
Source	Human fetal brain
Rouge ID	mKIAA1601 by Kazusa Mouse cDNA Project

Length: 3851 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1778 bp
Genome contig ID	gi89161205f_57702083
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CGTGCATGATTTAATAAAATAACTTTACTCTCCCT
Flanking genome sequence (187853 - 187902)	----+--------+--------+--------+--------+----* ACGCATGTTTGAGTTGAATATCATTGAAGTTCTTAATGCTGACTCTACTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	57802083	57889934	19	99.5	Perfect prediction

Length: 690 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW65350	1.5e-190	100.0	sarcolemma asso...	Homo sapiens
XP_001173855	5.4e-190	99.7	sarcolemma asso...	Pan troglodytes
XP_001098312	2.9e-189	99.3	similar to sarc...	Macaca mulatta
XP_857009	5.8e-187	97.8	similar to sarc...	Canis lupus fam...
XP_001489635	4.8e-186	97.2	sarcolemma asso...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058696	8.5e-07	31.0	KIAA1793
AB046785	0.00021	22.4	KIAA1565
AB037740	0.00039	24.9	KIAA1319

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002777	408	499	PF01920	Prefoldin beta-like
ScanRegExp	IPR001363	529	538	PS01255	Proteinase inhibitor I25C

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	667	PMLAALVAVTAIVLYVPGLARAS	689	PRIMARY	23

Primer_f	TATCATCAGAACTGCAACGGC
Primer_r	GCTTGGTTTTCTGCCTTACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-