Order Kazusa clone(s) from : ![]() |
Product ID | ORK06897 |
---|---|
Accession No | AB046821 |
Description | sarcolemma associated protein |
Clone name | fj10228 |
Vector information | |
cDNA sequence | DNA sequence (3851 bp) Predicted protein sequence (690 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1601
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1778 bp |
---|---|
Genome contig ID | gi89161205f_57702083 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (187853 - 187902) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 57802083 | 57889934 | 19 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002777 | 408 | 499 | PF01920 | Prefoldin beta-like |
ScanRegExp | IPR001363 | 529 | 538 | PS01255 | Proteinase inhibitor I25C |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 667 | PMLAALVAVTAIVLYVPGLARAS | 689 | PRIMARY | 23 |
---|
![]() |
Primer_f | TATCATCAGAACTGCAACGGC |
---|---|
Primer_r | GCTTGGTTTTCTGCCTTACTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |