KIAA1604

Product ID	ORK00255
Accession No	AB046824
Description	CWC22 spliceosome-associated protein
Clone name	fj10713
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3098 bp) Predicted protein sequence (937 aa)
HaloTag ORF Clone	FHC00255
Flexi ORF Clone	FXC00255
Source	Human fetal brain
Rouge ID	mKIAA1604 by Kazusa Mouse cDNA Project

Length: 3098 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	252 bp
Genome contig ID	gi89161199r_180417849
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CGCTTATATTTTGTGAATAAAATGATCAAAAGCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGATTCAGTGATGTTTTTTCAATTGACAAAATATTTTTTTAGTTGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	180517849	180566432	19	99.9	Perfect prediction

Length: 937 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5RA93	99.0	Nucampholin hom...	Pongo abelii
XP_001100012	97.2	similar to CG12...	Macaca mulatta
XP_001501165	93.5	similar to Nuca...	Equus caballus
XP_545549	93.3	similar to CG12...	Canis lupus fam...
XP_001157523	99.1	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003890	192	375	PF02854	MIF4G-like
HMMPfam	IPR003891	484	590	PF02847	Initiation factor eIF-4 gamma
HMMSmart	IPR003890	192	375	SM00543	MIF4G-like
HMMSmart	IPR003891	484	590	SM00544	Initiation factor eIF-4 gamma

Primer_f	ATCCTCTTCCTCTTCAGCGTC
Primer_r	TGAGGCAGAGCTATGACTACT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	ATCCTCTTCCTCTTCAGCGTC
Primer_r	TGAGGCAGAGCTATGACTACT
PCR product length	136 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles