KIAA1614

Product ID	ORK00879
Accession No	AB046834
Description	KIAA1614
Clone name	fj12973
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4143 bp) Predicted protein sequence (1208 aa)
HaloTag ORF Clone	FHC00879
Flexi ORF Clone	FXC00879
Source	Human fetal brain
Rouge ID	mKIAA1614 by Kazusa Mouse cDNA Project

Length: 4143 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	515 bp
Genome contig ID	gi89161185f_179048948
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCAACAAGAGCAAAACTTCATCTC
Flanking genome sequence (132916 - 132965)	----+--------+--------+--------+--------+----* AAAGGAAAAAAAAAAAGAAATAAATAAATTAGAATTTTGAAGGCCATCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	179148948	179181862	9	99.1	Perfect prediction

Length: 1208 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW91089	0	99.8	hCG24169, isofo...	Homo sapiens
XP_001111115	0	90.7	hypothetical pr...	Macaca mulatta
BAG52210	0	99.8	unnamed protein...	Homo sapiens
XP_001488925	0	71.2	similar to hCG2...	Equus caballus
AAH34090	4.1e-128	58.7	BC034090 protei...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GAGGCTTTTCTGGTCTTTGGC
Primer_r	CTAGAGAGCCCTGGACAATTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 1

Experimental conditions

Panel name	CCR
Primer_f	GAGGCTTTTCTGGTCTTTGGC
Primer_r	CTAGAGAGCCCTGGACAATTC
PCR product length	116 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles