KIAA1665

Product ID	ORK00883
Accession No	AB051452
Description	polymerase (RNA) III (DNA directed) polypeptide H (22.9kD), transcript variant 1
Clone name	hk01809
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4311 bp) Predicted protein sequence (217 aa)
HaloTag ORF Clone	FHC00883
Flexi ORF Clone	FXC00883
Source	Human adult brain
Rouge ID	mKIAA1665 by Kazusa Mouse cDNA Project

Length: 4311 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3453 bp
Genome contig ID	gi89161203r_40151776
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCTTAATAAGCAGCATAAATAAATATCTGACACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGGAGGCCTCTGGCCACACCAAAAAGGCTTGTTTTTGGTCGGTGCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	40251776	40270294	6	99.1	Perfect prediction

Length: 217 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y535	3.3e-92	100.0	DNA-directed RN...	Homo sapiens
BAE88415	4.8e-91	99.5	unnamed protein...	Macaca fascicularis
Q9D2C6	5e-90	98.0	DNA-directed RN...	Mus musculus
BAE31279	2.2e-89	97.5	unnamed protein...	Mus musculus
XP_001502570	2.6e-89	97.1	similar to poly...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005576	21	90	PF03876	RNA polymerase Rpb7
HMMPfam	IPR013238	92	214	PF08292	RNA polymerase III
ScanRegExp	IPR003006	85	91	PS00290	Immunoglobulin/major histocompatibility complex motif

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-