KIAA1713

Product ID	ORK04196
Accession No	AB051500
Description	additional sex combs like transcriptional regulator 3
Clone name	fh22344
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5779 bp) Predicted protein sequence (1652 aa)
Source	Human fetal brain
Note	We replaced fj19009, former representative clones for KIAA1713 with fh22344. (2002/5/10)

Length: 5779 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	818 bp
Genome contig ID	gi51511735f_29473153
PolyA signal sequence (None)	+--------+--------+----*----+---- TAGAGCTTCATGTGTGGCTTTTAAGAGCAGGTTTG
Flanking genome sequence (108224 - 108273)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGACCCTAAACTTCAAAGCAAGGAAATAAGATGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	29573153	29581375	2	99.0	Perfect prediction

Length: 1652 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C0F0	99.9	Putative Polyco...	Homo sapiens
XP_001101400	96.6	similar to addi...	Macaca mulatta
XP_001101584	96.6	similar to addi...	Macaca mulatta
XP_001101495	96.6	similar to addi...	Macaca mulatta
XP_001101677	96.6	similar to addi...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023195	0.00021	24.0	KIAA0978

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AATGAAATCCACTGTCCTGAG
Primer_r	TATTATCAGGTGTCAAAGGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-