Gene/Protein Characteristic Table for KIAA1713
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04196
Accession No AB051500
Description additional sex combs like transcriptional regulator 3
Clone name fh22344
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5779 bp)
Predicted protein sequence (1652 aa)
Source Human fetal brain
Note We replaced fj19009, former representative clones for KIAA1713 with fh22344. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 5779 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 818 bp
Genome contig ID gi51511735f_29473153
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAGAGCTTCATGTGTGGCTTTTAAGAGCAGGTTTG
Flanking genome sequence
(108224 - 108273)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGACCCTAAACTTCAAAGCAAGGAAATAAGATGCT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 18 f 29573153 29581375 2 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 1652 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9C0F0 0 99.9 Putative Polyco...
Homo sapiens
XP_001101400 0 96.6 similar to addi...
Macaca mulatta
XP_001101584 0 96.6 similar to addi...
Macaca mulatta
XP_001101495 0 96.6 similar to addi...
Macaca mulatta
XP_001101677 0 96.6 similar to addi...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023195 0.00021 24.0 KIAA0978
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AATGAAATCCACTGTCCTGAG
Primer_r TATTATCAGGTGTCAAAGGCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 18
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp