Order Kazusa clone(s) from : ![]() |
Product ID | ORK01635 |
---|---|
Accession No | AB051521 |
Description | ubiquitin-conjugating enzyme E2O |
Clone name | ph00331 |
Vector information | |
cDNA sequence | DNA sequence (5073 bp) Predicted protein sequence (1313 aa) |
Flexi ORF Clone | FXC01635 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1734
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1129 bp |
---|---|
Genome contig ID | gi51511734r_71797491 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 71897491 | 71960883 | 18 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000608 | 981 | 1098 | PD000461 | Ubiquitin-conjugating enzyme |
HMMPfam | IPR000608 | 978 | 1127 | PF00179 | Ubiquitin-conjugating enzyme |
HMMSmart | IPR000608 | 977 | 1134 | SM00212 | Ubiquitin-conjugating enzyme |
ProfileScan | IPR000608 | 977 | 1098 | PS50127 | Ubiquitin-conjugating enzyme |
![]() |
Primer_f | CTACCGGAGCTTCTTACCTGA |
---|---|
Primer_r | TACTTGTCCTCTGTGCACTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |