Order Kazusa clone(s) from : ![]() |
Product ID | ORK00906 |
---|---|
Accession No | AB051523 |
Description | autophagy/beclin-1 regulator 1, transcript variant 4 |
Clone name | ph00725 |
Vector information | |
cDNA sequence | DNA sequence (5067 bp) Predicted protein sequence (1244 aa) |
HaloTag ORF Clone |
FHC00906
![]() |
Flexi ORF Clone | FXC00906 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1736
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1036 bp |
---|---|
Genome contig ID | gi51511727r_46274540 |
PolyA signal sequence (ATTAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 46374540 | 46572147 | 17 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001680 | 100 | 131 | PD000018 | WD40 repeat |
HMMPfam | IPR001680 | 91 | 130 | PF00400 | WD40 repeat |
HMMSmart | IPR001680 | 56 | 87 | SM00320 | WD40 repeat |
IPR001680 | 90 | 130 | SM00320 | WD40 repeat | |
IPR001680 | 132 | 170 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 55 | 139 | PS50294 | WD40 repeat |
IPR001680 | 97 | 131 | PS50082 | WD40 repeat | |
ScanRegExp | IPR001680 | 117 | 131 | PS00678 | WD40 repeat |
![]() |
Primer_f | GTCTTCACTGTCCATTCCAAC |
---|---|
Primer_r | TCCCTCTCAGTCTGTGTTTCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |