Gene/Protein Characteristic Table for KIAA1736
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00906
Accession No AB051523
Description autophagy/beclin-1 regulator 1, transcript variant 4
Clone name ph00725
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5067 bp)
Predicted protein sequence (1244 aa)
Flexi ORF Clone FXC00906
Source Human brain (hippocampus)
Rouge ID mKIAA1736 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5067 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1036 bp
Genome contig ID gi51511727r_46274540
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
AAAGATCACATCATTAAAATGATGACATGCCCCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GCCAGGCTCCTCTCTCTTATTTCCAAGGAGGATGGGGGAGGGGTGGGGAT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 11 r 46374540 46572147 17 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 1244 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAM14520 0 95.5 autophagy/becli...
Mus musculus
XP_001163387 0 92.6 hypothetical pr...
Pan troglodytes
Q9C0C7 0 95.4 Activating mole...
Homo sapiens
BAG64009 0 95.3 unnamed protein...
Homo sapiens
XP_001112256 0 94.4 similar to WD r...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001680 100 131 PD000018 WD40 repeat
HMMPfam IPR001680 91 130 PF00400 WD40 repeat
HMMSmart IPR001680 56 87 SM00320 WD40 repeat
IPR001680 90 130 SM00320 WD40 repeat
IPR001680 132 170 SM00320 WD40 repeat
ProfileScan IPR001680 55 139 PS50294 WD40 repeat
IPR001680 97 131 PS50082 WD40 repeat
ScanRegExp IPR001680 117 131 PS00678 WD40 repeat
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GTCTTCACTGTCCATTCCAAC
Primer_r TCCCTCTCAGTCTGTGTTTCG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp