KIAA1759

Product ID	ORK00913
Accession No	AB051546
Description	family with sequence similarity 160, member A2, transcript variant 2
Clone name	fh22011s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (3354 bp) Predicted protein sequence (983 aa)
HaloTag ORF Clone	FHC00913
Flexi ORF Clone	FXC00913
Source	Human fetal brain
Rouge ID	mKIAA1759 by Kazusa Mouse cDNA Project
Note	We replaced fh22011, former representative clones for KIAA1759 with fh22011s1. (2002/5/10)

Length: 3354 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	171 bp
Genome contig ID	gi51511727r_6089141
PolyA signal sequence (TATAAA,-29)	+--------+--------+----*----+---- AATATGTATAAAAGGGAAATCTCTATTCTGTGCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTCTTTCCCATTTTTTTCTGTGGGGCTGGGGCCCCAGAAAAGGTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	6189141	6212422	12	99.8	Perfect prediction

Length: 983 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N612	100.0	UPF0518 protein...	Homo sapiens
AAH30825	99.9	FAM160A2 protei...	Homo sapiens
XP_001110422	98.6	similar to CG35...	Macaca mulatta
Q5R8V2	98.3	UPF0518 protein...	Pongo abelii
XP_862521	95.9	similar to CG35...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TCTTTCCTGCTCAACACCAAC
Primer_r	CCACGGGCAATGAGGTACTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 11

Experimental conditions

Panel name	CCR
Primer_f	AAGGTTCGTCTGGTGCCAAAG
Primer_r	GACAGGTGAAGCTCTCGTAGG
PCR product length	199 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles