Gene/Protein Characteristic Table for KIAA1789
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07429
Accession No AB058692
Description zinc finger, matrin-type 1, transcript variant 2
Clone name fh23186
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5751 bp)
Predicted protein sequence (477 aa)
Flexi ORF Clone FXC07429
Source Human fetal brain
Rouge ID mKIAA1789 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5751 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 851 bp
Genome contig ID gi89161218r_100924286
PolyA signal sequence
(AATGAA,-28)
+----*----+----*----+----*----+----
TTCCCTAAATGAAGTTGTCTCTACTTCTGCTCATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATTGCTGTGATAGTGAATTATTTATTCATGGGAGATAATTTATTTTAA
Features of the protein sequence
Description

Length: 477 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q5H9K5 4.8e-165 99.8 Zinc finger mat...
Homo sapiens
AAI52471 1.7e-164 100.0 Zinc finger, ma...
Homo sapiens
EAX02897 3.7e-164 99.8 hCG17853 [Homo ...
Homo sapiens
XP_001140711 5.1e-163 99.4 zinc finger, ma...
Pan troglodytes
XP_001096018 2e-158 96.4 similar to zinc...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 14 38 PF00096 Zinc finger
HMMSmart IPR015880 14 38 SM00355 Zinc finger
ScanRegExp IPR007087 16 38 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGGTCAAAGATAAGTGGAAGG
Primer_r AAGGAGAGAGGTTCAGTGAGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp