KIAA1821

Product ID	ORK06553
Accession No	AB058724
Description	RAB11 family interacting protein 4 (class II)
Clone name	fh12913
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5363 bp) Predicted protein sequence (609 aa)
Source	Human fetal brain
Rouge ID	mKIAA1821 by Kazusa Mouse cDNA Project

Length: 5363 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3531 bp
Genome contig ID	gi51511734f_26643079
PolyA signal sequence (None)	+--------+--------+----*----+---- GGCAACATAGTGATACCTTGTCTCTACCAAAAGTT
Flanking genome sequence (243324 - 243373)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGCTCAAGAACCTGCACGAGGGCCTAAAACAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	26743079	26886401	15	99.3	Perfect prediction

Length: 609 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86YS3	1.1e-192	100.0	Rab11 family-in...	Homo sapiens
XP_523772	4.3e-184	100.0	RAB11 family in...	Pan troglodytes
XP_585093	7.9e-183	94.9	similar to RAB1...	Bos taurus
XP_001109342	8.1e-183	99.0	similar to RAB1...	Macaca mulatta
EDM05395	1.4e-177	93.0	rCG34082 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014565	7.7e-27	39.8	KIAA0665

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR002048	21	56	PS50222	Calcium-binding EF-hand

Primer_f	TTTCAGAATCCTAGCTCCGGG
Primer_r	TCAGAAGGATGGAAGACTAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-