KIAA1906

Product ID	ORK07143
Accession No	AB067493
Description	transmembrane protein 132B
Clone name	ah00281
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6113 bp) Predicted protein sequence (593 aa)
Source	Human brain (amygdala)

Length: 6113 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4331 bp
Genome contig ID	gi89161190f_124594608
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCGTTTTTAACATGAAAATAAACATTTAAACATTC
Flanking genome sequence (114936 - 114985)	----+--------+--------+--------+--------+----* TTCAGTTGTTTCATTATTTTATCTGCATGTTCCATAAAGCAGCTGTATGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	124694608	124709542	4	99.1	Perfect prediction

Length: 593 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14DG7	100.0	Transmembrane p...	Homo sapiens
EAW98477	100.0	transmembrane p...	Homo sapiens
AAI13367	100.0	TMEM132B protei...	Homo sapiens
AAI31622	99.8	TMEM132B protei...	Homo sapiens
BAC04053	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075824	1.9e-75	52.7	KIAA1944

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	413	EIGMYALLCVFCLAILVFLINCV	435	PRIMARY	23

Primer_f	CTCAGAATACTCCATGTGTCC
Primer_r	AGTCTACAGATGTGGCAATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-