Gene/Protein Characteristic Table for KIAA1912
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00948
Accession No AB067499
Description coiled-coil domain containing 85A
Clone name fj18220
Vector information
The cDNA fragment was inserted at the NotI-SalI site of the ...
cDNA sequence DNA sequence (4069 bp)
Predicted protein sequence (589 aa)
Flexi ORF Clone FXC00948
Source Human fetal brain
Rouge ID mKIAA1912 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4069 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1821 bp
Genome contig ID gi89161199f_56164762
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CATCTTAGCAATGGTAATAAATTATTTAATCTCAC
Flanking genome sequence
(302052 - 302101)
----+----*----+----*----+----*----+----*----+----*
AGTGTCTTTGTCTTCTTCAAAATGTCTTTCCTAAATTGAGTCCATTTGTA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 2 f 56264762 56466812 6 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 589 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96PX6 2e-173 100.0 Coiled-coil dom...
Homo sapiens
EAX00077 3.8e-173 99.8 hCG1994544, iso...
Homo sapiens
XP_525759 6.6e-171 98.6 coiled-coil dom...
Pan troglodytes
XP_001496018 1.6e-160 94.4 similar to Coil...
Equus caballus
XP_223723 7.3e-130 84.8 similar to Delt...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom NULL 72 211 PD035968 NULL
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GTCAATCTCAAACAAGGTAGC
Primer_r AAAACACTGAGGCTCCACTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp