KIAA1940

Product ID	ORK05001
Accession No	AB075820
Description	F-box protein 41
Clone name	ah04227
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5627 bp) Predicted protein sequence (821 aa)
Source	Human brain (amygdala)
Rouge ID	mKIAA1940 by Kazusa Mouse cDNA Project

Length: 5627 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3161 bp
Genome contig ID	gi89161199r_73236457
PolyA signal sequence (None)	+--------+--------+----*----+---- TCTGAGCCAGCCCCTCAGGAATTGCCTCAAAAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAACAAAAAAAAGTCCTCCTTCCCAAGGCCTGCTACTCCAAGGTTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	73336457	73350104	12	99.9	Perfect prediction

Length: 821 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TF61	100.0	F-box only prot...	Homo sapiens
EAW99736	99.9	hCG1776403 [Hom...	Homo sapiens
NP_001073879	99.9	F-box protein 4...	Homo sapiens
XP_001103806	99.4	F-box protein 4...	Macaca mulatta
EDL91195	96.8	rCG56391 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020651	6.7e-06	39.5	KIAA0844

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001810	494	540	PF00646	Cyclin-like F-box

Primer_f	GCTTTATTCAGGCTGCTTCCC
Primer_r	TTGATCCTTAGGTGGTCTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-