KIAA1990

Product ID	ORK00964
Accession No	AB082521
Description	pyruvate dehydrogenase phosphatase regulatory subunit
Clone name	bf00083
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7999 bp) Predicted protein sequence (883 aa)
HaloTag ORF Clone	FHC00964
Flexi ORF Clone	FXC00964
Source	Human adult brain
Rouge ID	mKIAA1990 by Kazusa Mouse cDNA Project

Length: 7999 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4402 bp
Genome contig ID	gi51511732f_68605030
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGTAACAGAGTGAGACTCTTGTCTC
Flanking genome sequence (147657 - 147706)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAATCTAAGATAGAGGTTTGGTCAACAGTGCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	68705030	68752685	19	100.0	Perfect prediction

Length: 883 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8NCN5	100.0	Pyruvate dehydr...	Homo sapiens
AAI50252	100.0	Pyruvate dehydr...	Homo sapiens
BAF85191	99.7	unnamed protein...	Homo sapiens
CAH10555	99.0	hypothetical pr...	Homo sapiens
XP_001108170	99.2	similar to pyru...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006076	48	406	PF01266	FAD dependent oxidoreductase
	IPR006222	527	744	PF01571	Glycine cleavage T protein (aminomethyl transferase)
	IPR013977	751	860	PF08669	Glycine cleavage T-protein

Primer_f	ACGTGTGACTTCTGTTCTTAG
Primer_r	GCTCAGCAGTTAGTGTTTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-