KIAA0935

Product ID	ORK05911
Accession No	AB023152
Description	mannosidase, alpha, class 2B, member 2
Clone name	af13188
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7720 bp) Predicted protein sequence (952 aa)
Source	Human brain (amygdala)
Rouge ID	mKIAA0935 by Kazusa Mouse cDNA Project
Note	We replaced hh04630, former representative clones for KIAA0935 with af13188. (2005/08/06)

Length: 7720 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4859 bp
Genome contig ID	gi89161207f_6527843
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ACTAGAAACCAATGAATTAAAAACTTTGGAAGATG
Flanking genome sequence (147188 - 147237)	----+--------+--------+--------+--------+----* AATTTTATGGTCTGTGAATTATATCTCAATTTTAAAACTTTTTTTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	6627843	6675029	17	99.3	Perfect prediction

Length: 952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW82392	99.7	mannosidase, al...	Homo sapiens
AAH33307	100.0	Mannosidase, al...	Homo sapiens
Q9Y2E5	99.9	Epididymis-spec...	Homo sapiens
AAH94773	99.9	Mannosidase, al...	Homo sapiens
EAW82389	99.7	mannosidase, al...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000602	26	350	PF01074	Glycoside hydrolase
	IPR015341	354	437	PF09261	Glycoside hydrolase
	IPR011682	473	935	PF07748	Glycosyl hydrolases 38

Primer_f	CACAAAACACAAACCCAGGAC
Primer_r	GGATGAGTCTATGAAAACACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-