KIAA1881

Product ID	ORK05727
Accession No	AB067468
Description	perilipin 4
Clone name	ah02284
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6309 bp) Predicted protein sequence (1348 aa)
Source	Human brain (amygdala)
Rouge ID	mKIAA1881 by Kazusa Mouse cDNA Project

Length: 6309 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2261 bp
Genome contig ID	gi42406306r_4353210
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAACCAAGCCAATAAAAGTGATTTCTTTTTTCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAACCATTTATAGTCATTTCATGTTGGTTGGAAATCACAGAAATTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	4453210	4464705	11	98.4	Internal No-hit

Length: 1348 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW69214	99.3	hCG1646516 [Hom...	Homo sapiens
XP_001082322	79.1	similar to plas...	Macaca mulatta
XP_854446	67.6	similar to plas...	Canis lupus fam...
NP_065593	60.8	plasma membrane...	Mus musculus
EDL23717	60.8	plasma membrane...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029037	4.5e-07	20.5	KIAA1114

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	ATGCTGCAGAATGAGTTGGAG
Primer_r	TAAACGAACGAAGTAGCTCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-