Order Kazusa clone(s) from : ![]() |
Product ID | ORK05736 |
---|---|
Accession No | AB075854 |
Description | aminopeptidase-like 1 |
Clone name | ah03502 |
Vector information | |
cDNA sequence | DNA sequence (5610 bp) Predicted protein sequence (362 aa) |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA1974
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 2986 bp |
---|---|
Genome contig ID | gi51511747f_56600460 |
PolyA signal sequence (AGTAAA,-30) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (127243 - 127292) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | f | 56700460 | 56727701 | 14 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000819 | 205 | 222 | PR00481 | Peptidase M17 |
IPR000819 | 227 | 248 | PR00481 | Peptidase M17 | |
IPR000819 | 264 | 285 | PR00481 | Peptidase M17 | |
IPR000819 | 286 | 306 | PR00481 | Peptidase M17 | |
IPR000819 | 315 | 330 | PR00481 | Peptidase M17 | |
HMMPfam | IPR000819 | 128 | 328 | PF00883 | Peptidase M17 |
ScanRegExp | IPR000819 | 290 | 297 | PS00631 | Peptidase M17 |
![]() |
Primer_f | GACACACCCTGCAATGAGATG |
---|---|
Primer_r | TTTGCCAACCCCATAGATTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |