KIAA1974

Product ID	ORK05736
Accession No	AB075854
Description	aminopeptidase-like 1
Clone name	ah03502
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5610 bp) Predicted protein sequence (362 aa)
Source	Human brain (amygdala)
Rouge ID	mKIAA1974 by Kazusa Mouse cDNA Project

Length: 5610 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2986 bp
Genome contig ID	gi51511747f_56600460
PolyA signal sequence (AGTAAA,-30)	+--------+--------+----*----+---- GATTCAGTAAATTGGTTGTTTTCCTGTCTGCTTCG
Flanking genome sequence (127243 - 127292)	----+--------+--------+--------+--------+----* AGTCCTTGCCTCAAATGAGCCTTCAACAAGATAATGCATTGAAAAGCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	56700460	56727701	14	99.2	Perfect prediction

Length: 362 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG60029	1.1e-134	100.0	unnamed protein...	Homo sapiens
EAW75479	1.1e-134	100.0	aminopeptidase-...	Homo sapiens
CAH92294	1.2e-134	100.0	hypothetical pr...	Pongo abelii
Q5R7G6	1.2e-134	100.0	Probable aminop...	Pongo abelii
Q8NDH3	1.2e-134	100.0	Probable aminop...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000819	205	222	PR00481	Peptidase M17
	IPR000819	227	248	PR00481	Peptidase M17
	IPR000819	264	285	PR00481	Peptidase M17
	IPR000819	286	306	PR00481	Peptidase M17
	IPR000819	315	330	PR00481	Peptidase M17
HMMPfam	IPR000819	128	328	PF00883	Peptidase M17
ScanRegExp	IPR000819	290	297	PS00631	Peptidase M17

Primer_f	GACACACCCTGCAATGAGATG
Primer_r	TTTGCCAACCCCATAGATTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-